Distinct roles of haptoglobin-related protein and apolipoprotein L-I in trypanolysis by human serum

ApoL-I Is Necessary and Sufficient for Trypanosome Lysis.

As shown in Fig. 1, apoL-I^−/−HS was devoid of apoL-I but contained normal amounts of Hpr. The fraction of Hpr bound to HDLs, as revealed by its association with the HDL-specific protein apoA-I, was similar between apoL-I^−/−HS and NHS (Fig. 1). Moreover, the sequence of the Hpr gene of the apoL-I^−/− individual, determined after PCR amplification of the full Hpr coding sequence, was found to be entirely normal (data not shown). Conversely, Hp(r)^−/−HS was devoid of both Hp and Hpr while containing normal levels of HDL-bound apoL-I (Fig. 1).

Trypanosome survival assays were conducted over the course of 24 h in either 10% normal or mutant human sera (Fig. 2A). This long incubation period (approximately four generation times) was chosen to allow the detection of even traces of trypanolytic or trypanostatic activity. As reported previously (20), apoL-I^−/−HS was completely devoid of any trypanolytic activity because the number of trypanosomes living after 24 h of incubation in that serum was similar to that in fetal calf serum (FCS), which is nonlytic and contains neither apoL-I nor Hpr. Even in 100% apoL-I^−/−HS, trypanosomes grew as fast as in FCS (data not shown), whereas the trypanolytic activity of NHS could still be monitored after a 10⁵ dilution (Fig. 2B). However, the absence of Hpr had no effect on trypanosome survival because, as in NHS, the entire trypanosome population was lysed in Hp(r)^−/−HS (Fig. 2A). In both FCS and apoL-I^−/−HS, trypanolytic activity was restored after the addition of physiological levels (8.5 μg/ml) of recombinant apoL-I. In contrast, no lytic activity was demonstrated in FCS after the addition of even a 5-fold excess of recombinant Hpr that exhibited the natural processing characteristics of this protein into α-chains and β-chains as well as full capacity of Hb binding (14), although it was devoid of the hydrophobic signal peptide present in plasma-derived Hpr (Fig. 2A).

Hp(r)^−/−HS Exhibits Normal But Delayed Trypanolysis.

The phenotype of trypanolysis by NHS or Hp(r)^−/−HS was indistinguishable. In both cases, only NHS-sensitive, and not NHS-resistant, trypanosomes were lysed (Fig. 2B). Moreover, in each case, lysis typically was preceded by considerable lysosomal swelling (Fig. 3A). This effect is known to depend on active endocytosis, acidification of endosomes (5–7), and massive influx of chloride ions (10). Accordingly, in both sera, trypanolysis could be blocked at 4°C, inhibited by lysosomotropic basifying agents such as chloroquine, and prevented by the anionic channel inhibitor 4,4-diisothiocyanatostilbene-2,2-disulfonic acid (Fig. 3B).

Despite these phenotypic similarities, the absence of Hpr led to a significant delay in the trypanolytic process, particularly at high serum dilution. When incubated in 100% serum, the ratio in population midlysis time between Hp(r)^−/−HS and NHS was ≈1.65 (±0.11; n = 3), and this ratio reached 2.21 (±0.14; n = 3) in 30% serum (Fig. 3C). This effect was assessed by incubating trypanosomes in logarithmic dilutions of both sera. Although after 24 h of incubation lytic activity could still be detected after a 10⁵ dilution of NHS, lysis did not occur at >10³ dilution of Hp(r)^−/−HS (Fig. 3D). This trypanolytic potential was close to that obtained with equivalent levels of recombinant wild-type apoL-I directly added to FCS (Fig. 3D).

Hpr Mediates the Binding of TLF to a Specific Surface Receptor.

Taking advantage of the irreversibility of the lysis process (10), we preincubated trypanosomes at 37°C for increasing periods of time in 10% different human sera. Then, after washing, we resuspended them in 10% nonlytic FCS and incubated them for 24 h at 37°C. These experiments indicated that the parasite commitment to death (the minimal preincubation time required to trigger lysis) was reached 25 times quicker in NHS than in Hp(r)^−/−HS [midvalues of 5.0 min (±0.5; n = 3) versus 126.1 min (±19.9; n = 3) in 10% serum; Fig. 4A]. The same experiments were conducted after preincubating the trypanosomes at 4°C, a temperature low enough to completely inhibit lysis and endocytosis (5). In the case of NHS, no significant difference in trypanolysis could be demonstrated after preincubation at either 37°C or 4°C. In contrast, in the case of Hp(r)^−/−HS, trypanolysis was no longer detectable after preincubation at 4°C (Fig. 4A). Similar results were obtained by using FCS supplemented with free recombinant apoL-I (Fig. 4A). These data revealed that the absence of Hpr prevents the binding of TLF to trypanosomes at 4°C, suggesting that Hpr is required for the binding of TLF to a specific surface receptor.

To assess this hypothesis, we tested the effect on trypanolysis of adding a constant amount of free Hp or Hpr (200 μg/ml) to various dilutions of NHS. As expected from previous reports analyzing the effect of Hp on the activity of purified lytic particles (21–23), an excess of Hp was able to inhibit some, but not all, trypanolytic activity of NHS (Fig. 4B). Very similar results were obtained with recombinant Hpr (Fig. 4B). Therefore, Hp and Hpr appeared to interfere with TLF activity only when present in large excess, as would occur if these proteins were competing with TLF for binding to the trypanosome surface. That this effect was specific was indicated by the lack of inhibition observed with both proteins added to Hp(r)^−/−HS (Fig. 4B). Thus, these results further suggested the involvement of Hpr in the binding of HDL to the trypanosome surface. Such a conclusion was independently reached previously (24) and also was supported by the monitoring of intracellular trafficking of free Hp (Fig. 5). Hp appeared to rapidly and efficiently accumulate in the endocytic pathway, contrasting with the inefficient uptake of bovine serum albumin (BSA), a protein not specifically recognized by the parasite (Fig. 5).

The Mechanism of Lysis Does Not Involve Hpr.

To assess the hypothesis that apoL-I and Hpr act synergistically to generate full trypanolytic activity (11), we plotted the relationship between the time periods necessary in various NHS concentrations to achieve commitment to lysis (as determined by experiments involving preincubation with the lytic sera then incubation in nonlytic FCS; see Fig. 4A) and those necessary to observe complete lysis. The data, shown in Fig. 6, indicate that the time of lysis by NHS is related to the time required for commitment to lysis, both depending on the concentration of serum. This effect could be ascribed to later and longer times of lysosomal swelling when the number of internalized apoL-I molecules is reduced. This relationship also was measured for trypanolysis triggered by Hp(r)^−/−HS. As shown in Fig. 6, irrespective of the period required for cellular commitment to lysis, the time necessary for lysis after the commitment period was never longer in the absence of Hpr than in NHS. Again, similar results were obtained with FCS + recombinant apoL-I (Fig. 6). Thus, regardless of the presence or absence of Hpr, the lysis time could be predicted by that required for commitment to lysis, and the longer time of trypanolysis observed with Hp(r)^−/−HS could totally be assigned to slower uptake of the lytic component and not to the decrease in lytic activity. These data contradict the idea that apoL-I and Hpr work in synergy.

Trypanolysis Assays.

A NHS-sensitive clone of T. b. rhodesiense (ETat 1.2S) was used in all experiments. Trypanosomes, isolated from mice, were incubated at densities between 1.10⁵ and 1.10⁶/ml in HMI-9 medium (32) at 37°C in a CO₂-equilibrated incubator. At the indicated times, living trypanosomes were counted in triplicate under the microscope (three independent experiments). The specificity of the lytic activity was systematically checked by verifying the absence of lysis in another clone expressing the same variant surface glycoprotein (ETat 1.2 R) but resistant to NHS because of the synthesis of SRA (33).

Kinetics of TLF Uptake.

Trypanosomes, isolated from mice, were incubated at 1.10⁶/ml in HMI-9 or PSGS [2.5 mM NaH₂PO₄·H₂O/47.5 mM Na₂HPO₄·2H₂O/36.5 mM NaCl/1.5% (wt/vol) glucose/4.4% (wt/vol) sucrose, pH 8] under the indicated experimental conditions. Aliquots (100 μl) were centrifuged at 7,200 × g for 2 min at either 37°C or 4°C. Pelleted cells carefully were washed twice with HMI-9 medium supplemented with 10% FCS, resuspended in 1 ml HMI-9 + 10% FCS, and incubated for 24 h at 37°C in a CO₂-equilibrated incubator before being counted in triplicate under the microscope.

ApoA-I Immunoaffinity Chromatography and Western Blotting.

A total of 400 μg of rabbit anti-human apoA-I IgGs (Calbiochem, San Diego, CA) was incubated with 200 μl of washed Affi-Gel 10 (Bio-Rad, Hercules, CA) for 90 min at 4°C. Remaining active esters were blocked with 1 ml of 100 mM ethanolamine-HCl (pH 8) before extensive PBS washes. A total of 60 μl of gel was mixed with 400 μl of 20 × diluted NHS in PBS for 180 min at 4°C. Aliquots of unfractionated serum, flow-through, and bound fraction were subjected to SDS/PAGE. Western blots were incubated overnight at 4°C with a 1:100 dilution of a goat polyclonal monospecific anti-apoL-I antibody (Santa Cruz Biotechnology, Santa Cruz, CA) or with a 1:10,000 dilution of rabbit polyclonal anti-human Hp antibody (DAKO, Carpinteria, CA) in 150 mM NaCl/0.5% (wt/vol) Tween 20/20 mM Tris·HCl (pH 7.5) with 1% nonfat milk. The secondary antibodies were, respectively, peroxidase-conjugated mouse anti-goat IgGs (1:160,000; Sigma–Aldrich, St. Louis, MO) and peroxidase-conjugated mouse anti-rabbit IgGs (1:5,000; Promega, Madison, WI).

DNA Amplification and Sequencing.

Genomic DNA was extracted from peripheral blood cells. Five different primer sets (from 5′- to 3′-: CAGGTCCAAAGTTTGTAGACACAGG and TTTCTGCATCTGTACCAATGTATGC; GCATGTGCTGTGAAGCAGGGAGACC and CATCATGGAAATGTCAGAGCAGGGG; TGCCTTCTCACTCTGCTCTGGGTGC and GAAGGCTGTGCCTCTAGGACGTTCC; TCACCCCTTTCTCAGATGGAAAGGC and TGCAATCGTATTGGTCAGCCACAGG; and AGAGAGTGATGCCCATCTGCCTACC and TATCGCATCCACTCCTGTCCACTCC) were used to amplify the Hpr coding sequences from 100 ng of genomic DNA with Pwo DNA polymerase (Roche Diagnostics, Basel, Switzerland). Sequencing was condcuted directly on the amplification products.

Preparation of Recombinant Proteins.

Recombinant apoL-I and Hpr were prepared as described, respectively, in Vanhollebeke et al. (20) and Nielsen et al. (14). Their purity was checked by SDS/PAGE.

Immunofluorescence.

After incubation in 30% NHS, Hp(r)^−/−HS, and FCS for 150, 360, and 360 min, respectively, PBS-washed cells were fixed in 3.7% paraformaldehyde for 10 min at 20°C before being spread on poly(l-lysine)-coated slides and subsequently treated with 0.1% (vol/vol) Triton X-100 in Tris-buffered saline for 5 min at 20°C. p67 was detected with a 1:1,000 dilution of monoclonal anti-p67 antibody (mAb280; J. Bangs, D. Russell). Primary antibodies were detected with an Alexa (488)-conjugated goat anti-mouse secondary antibody (Molecular Probes, Eugene, OR). Cells were examined with a Zeiss Axioplan 2 epifluorescence microscope equipped with a Zeiss AxioCam HRm digital camera (Carl Zeiss, Thornwood, NY).